Background: : Sepsis is a life-threatening disease with dominant mortality. Its early diagnosis and treatment can improve prognosis and reduce mortality. Long noncoding RNAs (lncRNAs) ATPase plasma membrane Ca2+ transporting 1 antisense RNA 1 (ATP2B1-AS1) is dysregulated and is involved in the progression of various diseases. Nevertheless, the role of ATP2B1-AS1 in sepsis remains unclear.
Methods: A human monocytic cell line, THP-1 cells, was stimulated to induce a model of sepsis in vitro. The levels of ATP2B1-AS1, miR-23a-3p, and TLR4 were assessed by real-time quantitative polymerase chain reaction. The role of ATP2B1-AS1 in cell apoptosis and inflammation was explored by flow cytometry, Western blot analysis and enzyme-linked immunosorbent serologic assay. The binding sites between ATP2B1-AS1 and miR-23a-3p, and between miR-23a-3p and TLR4 were predicted by BiBiServ and the Encyclopedia of RNA Interactomes (ENCORI) online sites, respectively, and confirmed by the luciferase assay.
Results: The level of ATP2B1-AS1 was increased in lipopolysaccharide (LPS)-treated THP-1 cells. LPS increased apoptosis ratio, relative protein expressions of pro-apoptotic factors, and relative messenger RNA (mRNA) level and concentrations of pro-inflammatory cytokines, but decreased the relative expression of anti-apoptosis protein and relative mRNA level and concentrations of anti-inflammatory factor. All these alterations were reversed with transfection of shATP2B1-AS1 into THP-1 cells. Moreover, ATP2B1-AS1 directly bound miR-23a-3p and negatively modulated the level of miR-23a-3p. Meanwhile, TLR4 was directly targeted by miR-23a-3p, and negatively and positively modulated by miR-23a-3p and ATP2B1-AS1, respectively.
Conclusion: ATP2B1-AS1 aggravated apoptosis and inflammation by modulating miR-23a-3p/TLR4 axis in LPS-treated THP-1 cells.
Key words: apoptosis, ATP2B1-AS1, inflammation, miR-23a-3p, sepsis, TLR4
*Corresponding author: Xin Yang, Department of Pediatrics, the First Affiliated Hospital of Chengdu Medical College, No. 278, Middle of Baoguang Avenue, Xindu District, Chengdu, Sichuan Province 610500, China. Email address: [email protected]
Received 30 September 2022; Accepted 7 November 2022; Available online 1 March 2023
Copyright: Yang X, et al.
This open access article is licensed under Creative Commons Attribution 4.0 International (CC BY 4.0). http://creativecommons.org/licenses/by/4.0/
Sepsis is a life-threatening disease resulting from dysregulated inflammatory response to infection, which can rapidly progress to multiple organ injury and failure, septic shock, acidosis, and death.1 Sepsis is associated with dominant mortality, which is estimated as 26.7%.2 Moreover, it is shown that 41.9% sepsis patients treated in intensive care units (ICU) died before hospital discharge.2 Despite great advancements in the treatment of sepsis, such as early identification according to clinical biomarkers and characteristics, noninvasive treatment approaches, and clinical administration in non-ICUs, its incidence and mortality remain high.3,4 Fortunately, early diagnosis and treatment have been demonstrated to improve prognosis and diminish mortality of sepsis.5 Therefore, it is of great importance to explore more biomarkers and therapeutic targets for the clinical treatment of sepsis.
Long noncoding ribonucleic acids (lncRNAs) are RNAs with more than 200 nucleotides that play important roles in regulating various biological processes.6 Notably, it has been highlighted that lncRNAs are strongly involved in the diagnosis, treatment, and prognosis of sepsis.7,8 More importantly, lncRNAs can mediate the messenger RNA (mRNA) stability control and the activation of translation through competitively sponging to microRNAs (miRNAs),9 thereby participating in a wide range of diseases, including sepsis. For instance, lncRNA FGD5-AS1 attenuates inflammatory response via miR-133a-3p-dependent aquaporin-1 upregulation in lipopolysaccharide (LPS)-elicited sepsis.10 LncRNA NEAT1 sponges miR-125 to downregulate mast cell expressed membrane protein 1 (MCEMP1) to inhibit immunity during sepsis.11 LncRNA NKILA reduces cell viability and induces cell apoptosis, inflammation, and autophagy through miR-140-5p/CLDN2 axis in LPS-stimulated sepsis.12 LncRNA ATPase plasma membrane Ca2+ transporting 1 antisense RNA 1 (ATP2B1-AS1), also known as long intergenic non-protein-coding RNA 936 (LINC00936), is harbored in chr12:89,708,954–89,713,726 with a length of 3626-bp.13 ATP2B1-AS1 has been identified as one of the differentially expressed lncRNAs using microarray data analysis in colorectal cancer14 and acute myocardial infarction.15 Additionally, ATP2B1-AS1 modulates miR-330-5p/TLR4 axis to facilitate cerebral ischemia/reperfusion injury through MyD88/NF-κB signaling pathway.16 ATP2B1-AS1 regulates endothelial permeability in diabetic retinopathy through miR-4729--dependent IQGAP2 downregulation.17 ATP2B1-AS1/miR-221-3p/LAMA3 axis modulates the progression of ovarian cancer.18 However, the role of ATP2B1-AS1 in sepsis is still unclear.
Thus, in order to address the role and the mechanism of ATP2B1-AS1 in sepsis, human monocytic cell line THP-1 cells were challenged with LPS to induce a model of sepsis in vitro. The role of ATP2B1-AS1 in apoptosis and inflammation was explored in LPS-induced THP-1 cells. Additionally, the downstream target of ATP2B1-AS1 was identified.
THP-1 cells (CL-0233) were obtained from Procell (Wuhan, China) and cultured in Roswell Park Memorial Institute 1640 culture (RPMI-1640, PM150110; Procell) with 10% fetal bovine serum (FBS, 164210-50; Procell), 0.05-mM β-mercaptoethanol (PB180633; Procell), and penicillin–streptomycin (PB180120; Procell) with 5% CO2 at 37°C. THP-1 cells with a density of 2000 cells per well were plated into 96-well plates and cultured at 37°C. Then, THP-1 cells were treated with LPS (L8880; Solarbio, Beijing, China) for 24 h to establish the sepsis model in vitro. In order to screen the optimal concentration of LPS, 0.5-, 1-, and 2-µg/mL LPS was used to incubate THP-1 cells for 24 h.
Short hairpin RNA (shRNA) targeting ATP2B1-AS1 (shATP2B1-AS1), the corresponding negative control (shNC), miR-23a-3p mimic, NC mimic, miR-23a-3p inhibitor, and NC inhibitor were acquired from GenePharma (Shanghai, China). THP-1 cells were plated into 6-well plates with a density of 5×105 cells per well and incubated with 5% CO2 at 37°C. When cell density reached 70–80%, the shATP2B1-AS1, shNC, miR-23a-3p mimic, NC mimic, miR-23a-3p inhibitor, and NC inhibitor were transfected into THP-1 cells with Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA). After transfection for 48 h, cells were collected for the subsequent assays.
According to previous reports,19,20 the apoptosis of THP-1 cells was evaluated by flow cytometry. THP-1 cells were seeded into 12-well plates with a density of 2.5×105 cells per well and hatched with 5% CO2 at 37°C. After being yielded and rinsed with phosphate buffer saline (PBS, P1020; Solarbio), THP-1 cells were stained with Annexin V-FITC apoptosis detection kit (CA1020; Solarbio) and analyzed on a FACScan flow cytometry with the CellQuest software (BD Biosciences, NJ, USA) to determine cell apoptosis.
Following a previous study,21 THP-1 cells were treated with TRIzol reagent (15596026; Thermo Fisher Scientific, MA, USA) to extract total RNA. Then, total RNA (1 μg) was reverse transcribed into complementary DNA (cDNA) with the PrimeScript RT reagent kit (RR047A; Takara, Dalian, China). RT-qPCR was performed on the A PIKORed 96 (Thermo Fisher) by TB Green TM Premix Ex TaqTM Ⅱ (Tli RNaseH Plus) (RR820A; Takara). The PCR amplification conditions were 94°C for 10 min, 94°C for 10 s, and 55°C for 40 s in 40 cycles. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and U6 reference genes were applied as internal references of lncRNA, ATP2B1-AS1, and mRNA and miRNA, respectively. The expression levels of genes were presented with the comparative threshold cycle method (2-△△CT method). Primer sequences are exhibited in Table 1.
Table 1 Primer sequences used in the RT-qPCR.
| Name | Forward (5'-3') | Reverse (5'-3') |
|---|---|---|
| ATP2B1-AS1 | GGTAAATCGAGGCCCAGAGAT | ACGTGGATGACAGCGTGTGA |
| TNF-α | AGGACAGCAGAGGACCAGCTAAGAGG | TGCCACGATCAGGAAGGAGAAGAGG |
| IL-1β | TGGCGGACTCCAGCTACGAATCTC | TCTGTGGGCAGGGAACCAGCATCT |
| IL-6 | TTCGGTACATCCTCGACGGCATCTCA | GCACAGCTCTGGCTTGTTCCTCACT |
| IL-10 | GCCTAACATGCTTCGAGATC | TGATGTCTGGGTCTTGGTTC |
| TLR4 | AGACCTGTCCCTGAACCCTAT | CGATGGACTTCTAAACCAGCCA |
| GAPDH | TGACTTCAACAGCGACACCCA | CACCCTGTTGCTGTAGCCAAA |
| miR-23a-3p | TCTCATATGCAGGAGCCACCA | GCAAGTTGCTGTAGCCTCCTTG |
| U6 | CTCGCTTCGGCAGCACA | AACGCTTCACGAATTTGCGT |
Western blot assays were carried out based on previous descriptions.22,23 In brief, THP-1 cells were treated with radioimmunoprecipitation assay (RIPA) buffer (R0010; Solarbio), and the protein concentration was assessed by the BCA protein assay kit (PC0020; Solarbio). Protein samples (20 µg) were isolated and electrically transferred onto a polyvinylidene fluoride (PVDF) membrane (EMD Millipore; Billerica, MA, USA). The membranes were sealed with 5% skimmed milk (D8340; Solarbio) for 1 h at room temperature and incubated with the following antibodies overnight at 4°C targeting Bax (1:2000, ab182733; Abcam, Cambridge, UK), Bcl-2 (1:2000, ab196495; Abcam), cleaved Caspase 3 (1:500, ab2302; Abcam), Caspase 3 (1:500, ab13847; Abcam), TLR4 (1:1000, ab13556; Abcam), p-p65 (1:5000, ab86299; Abcam), p65 (1:500, ab16502; Abcam), and β-actin (1:5000, ab8227; Abcam). The membranes were visualized by the ECL Western blotting substrate (PE0010; Solarbio) after being probed with goat anti-rabbit immunoglobulin G (IgG) H&L (HRP, 1:20,000; Abcam) for 2 h at room temperature (PE0010; Solarbio). The gray value was examined by the QUANTITY ONE software (Bio-Rad, Hercules, CA, USA).
Concentrations of inflammatory cytokines in cell culture supernatant were measured by using commercial ELISA kits, including Human tumor necrosis factor-α (TNF-α) ELISA kIT (SEKH-0047; Solarbio), Human Interleukin (IL)-1β ELISA kIT (SEKH-0002; Solarbio), Human IL-6 ELISA kIT (SEKH-0013; Solarbio), and Human IL-10 ELISA kIT (SEKH-0018; Solarbio) following the instructions for use. The absorbance was detected with a microplate reader (Thermo Fisher Scientific) at 450 nm.
The binding sites between ATP2B1-AS1 and miR-23a-3p were predicted with BiBiServ online sites (https://bibiserv.cebitec.uni-bielefeld.de/rnahybrid?id=rnahybrid_view_submission), while those between miR-23a-3p and TLR4 were predicted with the Encyclopedia of RNA Interactomes (ENCORI) online sites (https://starbase.sysu.edu.cn/). The wild-type (WT) and mutant (MUT) ATP2B1-AS1 or TLR4 were cloned into pGL3-basic luciferase vector (Promega, Madison, WI, USA), and transfected into THP-1 cells. Both cells were then co-transfected with miR-23a-3p mimics or NC mimics (GenePharma) with Lipofectamine 3000 (Invitrogen). The luciferase activity was examined by Promega kit (Promega), after 48 h of transfection in line with the instruction manual.
Data were displayed as mean ± standard deviation (SD). The difference was determined by the Student's t-test between two groups, or by the one-way analysis of variance (ANOVA) for three or more groups, followed by post hoc Bonferroni test using the SPSS 26.0 software (IBM, Armonk, NY, USA). P ˂ 0.05 was considered as statistically significant.
An in vitro cell model of sepsis was first established by treating cells with LPS. In order to screen the optimal concentration of LPS, 0.5-, 1-, and 2-µg/mL LPS was used to incubate THP-1 cells for 24 h. Both 1- and 2-µg/mL LPS treatment significantly increased the early and late stages of apoptosis of THP-1 cells accompanied with a decrease in live cells, while 0.5-µg/mL LPS treatment did not exhibit the same effect on THP-1 cells (Figures 1A and B). Additionally, all three concentrations of LPS had no influence on necrosis cells. Moreover, all three concentrations of LPS markedly enhanced the relative expression of ATP2B1-AS1 in THP-1 cells (Figure 1C). Combining the collected data (Figures 1A–C), it was shown that the level of ATP2B1-AS was higher when the concentration of LPS was 1 µg/mL. When the concentration of LPS was increased, the expression of ATP2B1-AS did not elevate and the apoptosis ratio enhanced, indicating more cell deaths. Therefore, concentration of 1 µg/mL was chosen for the subsequent assays. Altogether, ATP2B1-AS1 was upregulated in LPS-challenged THP-1 cells.
Figure 1 ATP2B1-AS1 was upregulated in LPS-stimulated THP-1 cells. THP-1 cells were treated with 0-, 0.5-, 1-, and 2-µg/mL LPS for 24 h. (A and B) The apoptosis rate was detected by flow cytometry. Among them, cells in the bottom left quadrant Q4 (AnnexinV-FITC)-/PI- were living cells, cells in the bottom right quadrant Q3 (AnnexinV-FITC)+/PI- were early apoptotic cells, cells in the upper right quadrant Q2 (AnnexinV-FITC)+/PI+ were advanced apoptotic cells, and cells in the upper left quadrant Q1 (AnnexinV-FITC)-/PI+ were necrotic cells. (C) The relative expression of ATP2B1-AS1 was examined by RT-qPCR. The data were expressed after normalized with GAPDH. **P ˂ 0.01 and ***P ˂ 0.001 vs. 0 µg/mL LPS.
In order to investigate the role of ATP2B1-AS1 in sepsis, shRNA targeting ATP2B1-AS1 was prepared. Transfection of shATP2B1-AS1 significantly attenuated the LPS-induced relative level of ATP2B1-AS1 (Figure 2A) and the apoptosis ratio in THP-1 cells (Figures 2B and C). Meanwhile, LPS administration signally elevated the relative protein levels of Bax and cleaved Caspase 3/Caspase 3 and decreased the relative protein expression of Bcl-2, which were all notably reversed with the ATP2B1-AS1 silencing (Figure 2D). Therefore, knockdown of ATP2B1-AS1 suppressed apoptosis in LPS-exposed THP-1 cells.
Figure 2 Interference of ATP2B1-AS1 restrained LPS-induced apoptosis of THP-1 cells. THP-1 cells were transfected with shATP2B1-AS1 and stimulated with 1-µg/mL LPS for 24 h. (A) The relative expression of ATP2B1-AS1 was determined by RT-qPCR. The data were expressed after normalization with GAPDH. (B and C) The apoptosis ratio was analyzed by flow cytometry. (D) The relative protein expressions of Bax, Bcl-2, cleaved Caspase 3, and Caspase 3 were examined by Western blot analysis. The data were expressed after normalized with β-actin. **P ˂ 0.01 vs. control; $$P ˂ 0.01 and $$$P ˂ 0.001 vs. LPS.
Next, the role of ATP2B1-AS1 in inflammation was also explored in LPS-challenged THP-1 cells. The mRNA expressions in LPS-induced THP-1 cells and the concentrations of TNF-α, IL-6, and IL-1β in the cell culture supernatant were prominently upregulated, which were observably counteracted with transfection of shATP2B1-AS1 (Figures 3A and B). In addition, interference of ATP2B1-AS1 significantly rescued the LPS-induced levels of IL-10 in both THP-1 cells and cell culture supernatant (Figures 3A and B). Collectively, silencing of ATP2B1-AS1 attenuated the release of inflammatory cytokines in LPS-induced THP-1 cells.
Figure 3 Knockdown of ATP2B1-AS1 diminished LPS-induced release of inflammatory cytokines in THP-1 cells. THP-1 cells were transfected with shATP2B1-AS1 and stimulated with 1-µg/mL LPS for 24 h. (A) The mRNA expression levels of TNF-α, IL-6, IL-1β, and IL-10 were measured by RT-qPCR in THP-1 cells. The data were expressed after normalized with GAPDH. (B) The concentrations of TNF-α, IL-6, and IL-1β in cell culture supernatant were detected by ELISA. **P ˂ 0.01 and ***P ˂ 0.001 vs. control; $$P ˂ 0.01 and $$$P ˂ 0.001 vs. LPS.
Since lncRNA generally sponge to miRNA to regulate the expression of downstream genes, the potential targets of ATP2B1-AS1 were predicted by BiBiServ online site. Results demonstrated (Figure 4A) that ATP2B1-AS1 could bind miR-23a-3p because of the complementary base pairing. Moreover, direct binding between ATP2B1-AS1 and miR-23a-3p was verified by luciferase assay results, as indicated by a decrease in the relative luciferase activity upon co-transfection of ATP2B1-AS1-WT and miR-23a-3p mimics, but not ATP2B1-AS1-MUT and miR-23a-3p mimics (Figure 4B). Transfection of shATP2B1-AS1 observably reduced the relative ATP2B1-AS1 levels in both THP-1 cells and LPS-challenged THP-1 cells, indicating a viable interfering efficiency of shATP2B1-AS1 (Figure 4C, upper part). Meanwhile, transfection of shATP2B1-AS1 into THP-1 cells markedly increased the relative miR-23a-3p levels, LPS treatment notably deceased the relative miR-23a-3p levels, and interference of ATP2B1-AS1 prominently restored the LPS-induced relative miR-23a-3p levels in THP-1 cells (Figure 4C, lower part). Taken together, ATP2B1-AS1 directly bound miR-23a-3p and negatively modulated the expression of miR-23a-3p.
Figure 4 ATP2B1-AS1 directly bound miR-23a-3p but negatively modulated the level of miR-23a-3p. (A) The binding sites between ATP2B1-AS1 and miR-23a-3p were predicted by BiBiServ online sites. (B) The direct binding between ATP2B1-AS1 and miR-23a-3p was examined by luciferase assay. ***P ˂ 0.001 vs. NC mimic. (C) The relative levels of ATP2B1-AS1 and miR-23a-3p were detected by RT-qPCR in THP-1 cells. The data were expressed after normalized with GAPDH or U6. **P ˂ 0.01 and ***P ˂ 0.001 vs. shNC; $$P ˂ 0.01 and $$$P ˂ 0.001 vs. shATP2B1-AS1; #P ˂ 0.05 and ###P ˂ 0.001 vs. LPS+shNC.
More importantly, the downstream targets of miR-23a-3p were analyzed by ENCORI online sites. TLR4 was predicted to be one of the targets of miR-23a-3p because of complementary base pairing (Figure 5A), which was confirmed by luciferase assay results (Figure 5B). Transfection of miR-23a-3p inhibitors into THP-1 cells effectively decreased the relative miR-23a-3p level but significantly enhanced the relative TLR4 mRNA level (Figure 5C). In addition, suppression of miR-23a-3p prominently enhanced the relative protein level of TLR4 and its downstream protein p65 (Figure 5D). Moreover, silencing of ATP2B1-AS1 observably reduced the relative TLR4 mRNA level, and LPS induced the relative TLR4 mRNA level in THP-1 cells (Figure 5E). Similar results were also observed in the relative protein expression of TLR4 and its downstream protein p65 (Figure 5F). Briefly, these data demonstrated that TLR4 was targeted by miR-23a-3p and positively regulated by ATP2B1-AS1.
Figure 5 MiR-23a-3p targeted TLR4. (A) The binding sites between miR-23a-3p and TLR4 were predicted by ENCORI online sites. (B) The direct binding between miR-23a-3p and TLR4 was determined by luciferase assay. ***P ˂ 0.001 vs. NC mimic. (C) The relative levels of miR-23a-3p and TLR4 were examined by RT-qPCR in THP-1 cells. The data were expressed after normalized with U6 or GAPDH. ***P ˂ 0.001 vs. NC inhibitor. (D) The relative protein expressions of TLR4, p-p65, and p65 were detected by Western blot analysis. The data were expressed after normalized with β-actin. **P ˂ 0.01 and ***P ˂ 0.001 vs. NC inhibitor. (E) The relative levels of TLR4 were measured by RT-qPCR in THP-1 cells. The data were expressed after normalized with GAPDH. **P ˂ 0.01 and ***P ˂ 0.001 vs. shNC; $$$P ˂ 0.001 vs. shATP2B1-AS1; #P ˂ 0.05 vs. LPS+shNC. (F) The relative protein expressions of TLR4, p-p65, and p65 were detected by Western blot analysis. The data were expressed after normalized with β-actin. **P ˂ 0.01 and ***P ˂ 0.001 vs. shNC; $$$P ˂ 0.001 vs. shATP2B1-AS1; ###P ˂ 0.001 vs. LPS+shNC.
In the current study, THP-1 cells were stimulated with LPS to induce an in vitro sepsis model. The level of ATP2B1-AS1 was elevated in LPS-treated THP-1 cells. Silencing of ATP2B1-AS1 attenuated the LPS-elicited apoptosis and inflammation in THP-1 cells. Moreover, ATP2B1-AS1 directly bound miR-23a-3p and negatively modulated the level of miR-23a-3p. Meanwhile, TLR4 was directly targeted by miR-23a-3p, and was modulated negatively and positively by miR-23a-3p and ATP2B1-AS1, respectively. Taken together, ATP2B1-AS1 exacerbated apoptosis and inflammation by modulating miR-23a-3p/TLR4 axis in LPS-evoked THP-1 cells.
A large number of lncRNAs have been discovered to be dysregulated in sepsis, which is closely associated with its diagnosis, treatment, and prognosis.7,8 Upregulation of lncRNA NEAT 1 is interrelated in biochemical indicators, acute respiratory distress syndrome risk, disease severity, and 28-day mortality in sepsis.24 Circulating lncRNA MALAT1 is upregulated and can indicate disease severity, risk, and survival in patients with sepsis.25 Circulating lncRNA ZFAS1 is downregulated and is negatively correlated with inflammatory markers, disease severity, and disease risk, and predicts poor prognosis of patients with sepsis.26 ATP2B1-AS1, a novel lncRNA, is highly expressed in cerebral ischemia/reperfusion injury16 and myocardial infarction.13,27 In line with these findings, our results consistently revealed that the level of ATP2B1-AS1 was enhanced in LPS-induced THP-1 cells. Thus, ATP2B1-AS1 might be a marker for the diagnosis of sepsis, and a potential target for the treatment of sepsis.
Several important pathogenic mechanisms are tightly involved in the development of sepsis, among which inflammation and apoptosis are nonnegligible.28 Numerous studies have shown that attenuation of inflammation and apoptosis can contribute to the improvement of sepsis. Inhibition of apoptosis and inflammation by knockdown of miR-181a represses sepsis through regulating Nrf2- and NF-κB-signaling pathways.29 MiR-128-3p can alleviate sepsis by suppressing apoptosis and inflammation by targeting TGFBR2.30 In addition, lncRNAs also participate in the regulation of apoptosis and inflammation in sepsis. Downregulation of lncRNA GAS5 suppressed apoptosis and inflammation to relieve sepsis through miR-23a-3p/TLR4 axis.31 Silencing of lncRNA NKILA restrains apoptosis and inflammation by miR-140-5p/CLDN2 axis in LPS-evoked sepsis.12 Here, LPS evoked an increase in the apoptosis ratio and the levels of pro-apoptotic factors and pro-inflammatory cytokines with the decreased levels of anti-apoptosis protein and anti-inflammatory factor, which were reversed by the interference of ATP2B1-AS1 in THP-1 cells. Similar results, that downregulation of ATP2B1-AS1 dampens apoptosis and the inflammation cytokines level, have been verified in myocardial infarction13 and cerebral ischemia/reperfusion injury.16 Collectively, these outcomes elucidated that ATP2B1-AS1 restrained apoptosis and inflammation in LPS-stimulated THP-1 cells.
LncRNA can sponge to miRNAs to competitively impede their function, thereby modulating the expression level of miRNA target genes.32 Here, we found that ATP2B1-AS1 directly bound miR-23a-3p and negatively modulated the level of miR-23a-3p. MiR-23a-3p has been revealed to be downregulated in LPS-treated RAW264.7 cells and patients with sepsis.33 More importantly, miR-23a-3p has been highlighted to be sponged by different lncRNAs to take part in a variety of diseases. For instance, lncRNA PAHRF sponges miR-23a-3p to mediate proliferation and apoptosis in pulmonary arterial hypertension.34 LncRNA GAS5 sponging miR-23a-3p induces apoptosis and inflammation in sepsis.31 Also, our results showed that miR-23a-3p could further directly target TLR4, and negatively regulate the TLR4 expression. The direct targeting relationship between miR-23a-3p and TLR4 has been verified in LPS-treated THP-1 cells, in which upregulation of TLR4 dampens the suppressive effects of miR-23a-3p upregulation on LPS-evoked apoptosis and inflammation.31 TLR4 is identified as a prominent risk of posttraumatic sepsis.35 TLR4 expression combined with C-reactive protein is a reliable biomarker for the diagnosis of late-onset neonatal sepsis.36 In addition, TLR4, as one of the classical pattern recognition receptors, can be recognized by LPS to induce the activation of downstream signaling pathway, such as nuclear factor-κB (NF-κB) signaling pathway. TLR4/NF-κB pathway is closely related to inflammation and apoptosis.37,38 Activated TLR4 can induce the release of inflammatory cytokines, including IL-1β and TNF-α, which are mediated by NF-κB.39 TLR4/NF-κB pathway also plays a significant role in different diseases, including sepsis.40,41 In the current study, LPS enhanced the relative protein level of p-p65/p-65 in THP-1 cells, which indicated the activation of NF-κB pathway in sepsis. Furthermore, suppression of ATP2B1-AS1 decreased the LPS-induced relative protein level of p-p65/p-65 in THP-1 cells. Thus, in combination with the results that suppression of miR-23a-3p elevated the relative protein level of p-p65/p-65, the results indicated that the role of ATP2B1-AS1/miR-23a-3p/TLR4 axis in LPS-challenged THP-1 cells was closely related to the NF-κB pathway. Taken together, the role of ATP2B1-AS1 in LPS-treated THP-1 cells was related to the miR-23a-3p/TLR4 axis.
Our results suggested that the level of ATP2B1-AS1 was enhanced in LPS-induced THP-1 cells. ATP2B1-AS1 contributed to apoptosis and inflammation of LPS-challenged THP-1 cells by regulating miR-23a-3p/TLR4 axis. However, several limitations remain to be discussed in the future research. An in vivo model and in vivo experiments need to be conducted in the future study. In addition, the role of NF-κB pathway can be explored in the regulation of ATP2B1-AS1/miR-23a-3p/TLR4 axis in LPS-stimulated THP-1 cells. Briefly, our study identified that ATP2B1-AS1 might be a marker for the diagnosis of sepsis as well as a potential target for its treatment.
This work was supported by the Sichuan Province Medical (Youth Innovation) Research Project (Q21026) and the Chengdu Medical Research Project (2022328).
The authors stated that there was no conflict of interest to disclose.
This research had no human or animal participants to perform experiments by any of its authors.
Written informed consent was obtained from a legally authorized representative(s) of an anonymized patient for information published in this study.
The authors declare that all data supporting the findings of this study are available within the paper, and any raw data can be obtained from the corresponding author upon request.
Xin Yang and Liqun Lu designed and carried the study. Xin Yang, Liqun Lu, Chan Wu, and Feng Zhang supervised data collection, and analyzed and interpreted the collected data. Xin Yang prepared the manuscript and reviewed its draft for publication. All authors had read and approved the final manuscript.
1. Rhodes A, Evans LE, Alhazzani W, Levy MM, Antonelli M, Ferrer R, et al. Surviving sepsis campaign: International guidelines for management of sepsis and septic shock: 2016. Intensive Care Med. 2017;43(3):304–77. 10.1007/s00134-017-4683-6
2. Fleischmann-Struzek C, Mellhammar L, Rose N, Cassini A, Rudd KE, Schlattmann P, et al. Incidence and mortality of hospital-and ICU-treated sepsis: Results from an updated and expanded systematic review and meta-analysis. Intensive Care Med. 2020;46(8):1552–62. 10.1007/s00134-020-06151-x
3. Mirijello A, Tosoni A, On Behalf of the Internal Medicine Sepsis Study G. New strategies for treatment of sepsis. Medicina (Kaunas). 2020;56(10):527. 10.3390/medicina56100527
4. Kim Y-J, Lee J-H, Lee S-W, Kim WY. Use of quick sequential organ failure assessment score-based sepsis clinical decision support system may be helpful to predict sepsis development. Signa Vitae. 2021;17(5):86–94.
5. Rhee C, Dantes R, Epstein L, Murphy DJ, Seymour CW, Iwashyna TJ, et al. Incidence and trends of sepsis in US hospitals using clinical vs claims data, 2009–2014. JAMA. 2017;318(13):1241–9. 10.1001/jama.2017.13836
6. Geisler S, Coller J. RNA in unexpected places: Long non-coding RNA functions in diverse cellular contexts. Nat Rev Mol Cell Biol. 2013;14(11):699–712. 10.1038/nrm3679
7. Liao Y, Wang R, Wen F. Diagnostic and prognostic value of long noncoding RNAs in sepsis: A systematic review and meta--analysis. Expert Rev Mol Diagn. 2022:22(8):821–31. 10.1080/14737159.2022.2125801
8. Pierce JB, Zhou H, Simion V, Feinberg MW. Long Noncoding RNAs as therapeutic targets. Adv Exp Med Biol. 2022;1363: 161–75. 10.1007/978-3-030-92034-0_9
9. Szcześniak MW, Makałowska I. lncRNA–RNA interactions across the human transcriptome. PLoS One. 2016;11(3):e0150353. 10.1371/journal.pone.0150353
10. Chu Y, Wang X, Yu N, Li Y, Kan J. Long noncoding RNA FGD5-AS1/microRNA-133a-3p upregulates aquaporin 1 to decrease the inflammatory response in LPS-induced-sepsis. Mol Med Rep. 2021;24(5):784. 10.3892/mmr.2021.12424
11. Chen JX, Xu X, Zhang S. Silence of long noncoding RNA NEAT1 exerts suppressive effects on immunity during sepsis by promoting microRNA-125-dependent MCEMP1 downregulation. IUBMB Life. 2019;71(7):956–68. 10.1002/iub.2033
12. Han D, Fang R, Shi R, Jin Y, Wang Q. LncRNA NKILA knockdown promotes cell viability and represses cell apoptosis, autophagy and inflammation in lipopolysaccharide-induced sepsis model by regulating miR-140-5p/CLDN2 axis. Biochem Biophys Res Commun. 2021;559:8–14. 10.1016/j.bbrc.2021.04.074
13. Song KY, Zhang XZ, Li F, Ji QR. Silencing of ATP2B1-AS1 contributes to protection against myocardial infarction in mouse via blocking NFKBIA-mediated NF-κB signalling pathway. J Cell Mol Med. 2020;24(8):4466–79. 10.1111/jcmm.15105
14. Chodary Khameneh S, Razi S, Shamdani S, Uzan G, Naserian S. Weighted correlation network analysis revealed novel long non-coding RNAs for colorectal cancer. Sci Rep. 2022;12(1):2990. 10.1038/s41598-022-06934-w
15. Sheng X, Fan T, Jin X. Identification of key genes involved in acute myocardial infarction by comparative transcriptome analysis. Biomed Res Int. 2020;2020:1470867. 10.1155/2020/1470867
16. Wang L, Tan Y, Zhu Z, Chen J, Sun Q, Ai Z, et al. ATP2B1-AS1 promotes cerebral ischemia/reperfusion injury through regulating the miR-330-5p/TLR4-MyD88-NF-κB signaling pathway. Front Cell Dev Biol. 2021;9:720468. 10.3389/fcell.2021.720468
17. Ren Z, Wang X. Long non-coding ribonucleic acid ATP2B1-AS1 modulates endothelial permeability through regulating the miR-4729-IQGAP2 axis in diabetic retinopathy. J Diabetes Investig. 2022;13(3):443–52. 10.1111/jdi.13740
18. Shu C, Wang W, Wu L, Qi C, Yan W, Lu W, et al. LINC00936/microRNA-221-3p regulates tumor progression in ovarian-cancer by interacting with LAMA3. Recent Pat Anticancer Drug Discov. 2022. 10.2174/1574892817666220316152201. Epub ahead of print.
19. Xiao Q, Lu R, He C, Zhou K. Protective effect of USP22 against paraquat-induced lung injury via activation of SIRT1/NRF2 pathway. Signa Vitae. 2021;17(3):187–95.
20. Sun S, Yao M, Yuan L, Qiao J. Long-chain non-coding RNA n337374 relieves symptoms of respiratory syncytial virus--induced asthma by inhibiting dendritic cell maturation via the CD86 and the ERK pathway. Allergol Immunopathol (Madr). 2021;49(3):100–7. 10.15586/aei.v49i3.85
21. Gai Y, Hao Y, Guo K. PIM2 promotes lung adenocarcinoma cell migration by regulating XIAP/NF-κB pathway. J Men Health (JOMH). 2021;17(3):153–9.
22. Fu Y, Jin R-R, Li Y-L, Luan H, Huang T, Zhao Y, et al. Isocorydine inhibits the proliferation of human endometrial carcinoma HEC-1B cells by downregulating the Ras/MEK/ERK signaling pathway. Eu J Gynaecol Oncol (EJGO). 2021;42(3):548–53. 10.31083/j.ejgo.2021.03.5225
23. Chhabra R, Rao S, Kumar BM, Shetty AV, Hegde AM, Bhandary M. Characterization of stem cells from human exfoliated deciduous anterior teeth with varying levels of root resorption. J Clin Pediatr Dent. 2021;45(2):104–11. 10.17796/1053-4625-45.2.6
24. Yang Y, Yang L, Liu Z, Wang Y, Yang J. Long noncoding RNA NEAT 1 and its target microRNA-125a in sepsis: Correlation with acute respiratory distress syndrome risk, biochemical indexes, disease severity, and 28-day mortality. J Clin Lab Anal. 2020;34(12):e23509. 10.1002/jcla.23509
25. Geng F, Liu W, Yu L. Potential role of circulating long noncoding RNA MALAT1 in predicting disease risk, severity, and patients’ survival in sepsis. J Clin Lab Anal. 2019;33(8):e22968. 10.1002/jcla.22968
26. Xu Y, Shao B. Circulating long noncoding RNA ZNFX1 antisense RNA negatively correlates with disease risk, severity, inflammatory markers, and predicts poor prognosis in sepsis patients. Medicine (Baltimore). 2019;98(9):e14558. 10.1097/MD.0000000000014558
27. Xu L, Wang F. LINC00936 exacerbated myocardial infarction progression via miR-4795-3p/Wnt3a signaling pathway based on biological and imaging methods. Perfusion. 2022:2676591221076788. 10.1177/02676591221076788
28. Huang M, Cai S, Su J. The Pathogenesis of sepsis and potential therapeutic targets. Int J Mol Sci. 2019;20(21):5376. 10.3390/ijms20215376
29. Wu Z, Chen J, Zhao W, Zhuo CH, Chen Q. Inhibition of miR-181a attenuates sepsis-induced inflammation and apoptosis by activating Nrf2 and inhibiting NF-κB pathways via targeting SIRT1. Kaohsiung J Med Sci. 2021;37(3):200–7. 10.1002/kjm2.12310
30. Yang P, Han J, Li S, Luo S, Tu X, Ye Z. miR-128-3p inhibits apoptosis and inflammation in LPS-induced sepsis by targeting TGFBR2. Open Med (Wars). 2021;16(1):274–83. 10.1515/med-2021-0222
31. Gao Z, Huang D. lncRNA GAS5-mediated miR-23a-3p promotes inflammation and cell apoptosis by targeting TLR4 in a cell model of sepsis. Mol Med Rep. 2021;24(1):510. 10.3892/mmr.2021.12149
32. Zhao Z, Sun W, Guo Z, Zhang J, Yu H, Liu B. Mechanisms of lncRNA/microRNA interactions in angiogenesis. Life Sci. 2020;254:116900. 10.1016/j.lfs.2019.116900
33. Sun Q, Wang B, Li M. MicroRNA-23a-3p targeting of HMGB1 inhibits LPS-induced inflammation in murine macrophages in vitro. Exp Ther Med. 2022;23(5):322. 10.3892/etm.2022.11251
34. Liu Y, Hu R, Zhu J, Nie X, Jiang Y, Hu P, et al. The lncRNA PAHRF functions as a competing endogenous RNA to regulate MST1 expression by sponging miR-23a-3p in pulmonary arterial hypertension. Vascul Pharmacol. 2021;139:106886. 10.1016/j.vph.2021.106886
35. Djuric O, Andjelkovic M, Vreca M, Skakic A, Pavlovic S, Novakovic I, et al. Genetic variants in TNFA, LTA, TLR2 and TLR4 genes and risk of sepsis in patients with severe trauma: Nested case-control study in a level-1 trauma centre in SERBIA. Injury. 2021;52(3):419–25. 10.1016/j.injury.2020.12.039
36. Rohsiswatmo R, Azharry M, Sari TT, Bahasoan Y, Wulandari D. TLR2 and TLR4 expressions in late-onset neonatal sepsis: Is it a potential novel biomarker? J Neonatal Perinatal Med. 2021;14(3):361–7. 10.3233/NPM-200411
37. Chen F, Zhu J, Wang W. Ulinastatin attenuates LPS-induced inflammation and inhibits endoplasmic reticulum stress-induced apoptosis in renal tubular epithelial cells via regulation of the TLR4/NF-κB and Nrf2/HO-1 pathways. Inflammation. 2021;44(6):2323–32. 10.1007/s10753-021-01505-z
38. Zhang H, Lang W, Wang S, Li B, Li G, Shi Q. Echinacea polysaccharide alleviates LPS-induced lung injury via inhibiting inflammation, apoptosis and activation of the TLR4/NF-κB signal pathway. Int Immunopharmacol. 2020;88:106974. 10.1016/j.intimp.2020.106974
39. Roy A, Srivastava M, Saqib U, Liu D, Faisal SM, Sugathan S, et al. Potential therapeutic targets for inflammation in toll-like receptor 4 (TLR4)-mediated signaling pathways. Int Immunopharmacol. 2016;40:79–89. 10.1016/j.intimp.2016.08.026
40. Song C, Adili A, Kari A, Abuduhaer A. FSTL1 aggravates sepsis-induced acute kidney injury through regulating TLR4/MyD88/NF-κB pathway in newborn rats. Signa Vitae. 2021;17(3):167–73.
41. Ni WW, Zhang QM, Zhang X, Li Y, Yu SS, Wu HY, et al. Modulation effect of Lactobacillus acidophilus KLDS 1.0738 on gut microbiota and TLR4 expression in β-lactoglobulin-induced allergic mice model.Allergol Immunopathol (Madr). 2020;48(2):149–57. 10.1016/j.aller.2019.06.002